pegfp sec23a  (Addgene inc)

Journal: bioRxiv

Article Title: The axonal ER couples translation and secretion machineries for local delivery of axonal transmembrane proteins to promote axonal development

doi: 10.1101/2025.09.09.674816

Figure Lengend Snippet: (A-B) Representative images of DIV9-10 axons expressing SEC23A together with SEC24D, SEC31A or SEC16B (A). Quantification of colocalization between SEC23A and SEC24D, SEC31A or SEC16B (B). (C) Representative still and time-lapse from zoomed regions showing the tight association between SEC23A and the axonal ER labelled with SEC61β. Images were acquired at 1-second intervals for 80 seconds. See Video S4. (D-F) Schematic showing the Strep-SBP heterodimerization system using Strep-KIFC1 and SBP-RTN4 to relocate axonal ER to the soma (D). Representative images of SEC23A and RTN4 in DIV10 neurons in the absence (control) or presence of KIFC1 motor (pulled) (E). Quantification of SEC23A number from conditions in (E) in 100 μm axons (F). (G-J) Schematic showing the FKBP-FRB heterodimerization system using KIFC1-FRB and FKBP-SEC23A to relocate axonal ERES components to the soma (G). Representative images of SEC23A treated with ethanol (vehicle, control) or Rapalog for 16h (H). Representative images of RUSH-SYT1 cargos in neurons treated as in (H) for 16h, prior biotin addition for 4h in the presence of BFA and BDNF (I). Quantification of RUSH-SYT1 cargo number from conditions in (I) in 100 μm axons (J). (K-L) Distribution of SEC23A in the axon in control BSA and after 30 min BDNF stimulation (K). Quantification of SEC23A puncta number per 100 μm axon (L). (M-O) Schematic showing the timeline of different treatments before fixation (M). Representative images of DIV10-11 neurons expressing RUSH-SYT1 after 4h biotin release, 4h biotin release and pre-treated with BFA alone, or 4h biotin release together with BFA and BDNF. Live cell surface labeling for HA-tag inserted in the luminal/extracellular domain of RUSH-SYT1, allows for the visualization of SYT1 fusion with the PM (N). Quantification of the percentage of released cargos fusing with the PM (O). See also related Figure S5. Data are presented as box-and-whisker plots in (B, F, J, L, O). Individual data points each represent a neuron, and each color per bar represents an independent experiment. *p < 0.05, **p < 0.01, *** p < 0.001, ****p<0.001 comparing conditions using unpaired t-test in (F, J, L) or ordinary one-way ANOVA test followed by Tukey’s multiple comparisons test in (O). Scale bars represent 10 μm in (A, E, H, I, K, N), 5 μm in the overview image, and 1 μm in cropped images in (C).

Article Snippet: The SEC23A fragment was PCR amplified from EGFP-SEC23A (Addgene plasmid #66609) and inserted into either mCh-SBP-C1 or GFP(A206K)-SBP-C1 plasmids between SalI and BamHI restriction sites.

Techniques: Expressing, Control, Labeling, Whisker Assay

Journal: bioRxiv

Article Title: The axonal ER couples translation and secretion machineries for local delivery of axonal transmembrane proteins to promote axonal development

doi: 10.1101/2025.09.09.674816

Figure Lengend Snippet: (A-C) Schematic showing the Strep-SBP heterodimerization system using Strep-KIFC1 and SBP-SEC23A to relocate axonal ERES components to the soma (A). Representative images of neurons DIV9 co-transfected with SBP-SEC23A and V5-SEC13 in the absence (control) or presence of Strep-KIFC1 (pulled) (B). Quantification of SEC23A and SEC13 puncta in axon (C). (D-E) Representative images of neurons transfected with SBP-SEC23A alone or with Strep-KIFC1 and stained for endogenous SEC31A (D). Quantification of SEC23A and endogenous SEC31A puncta in the axon (E). (F-G) Representative images of neurons transfected with SBP-SEC23A alone or with Strep-KIFC1 and stained for endogenous RTN4 for axonal ER labeling (F). Quantification of average ER intensity in the axon (G). (H-J) Representative images of DIV4 neurons transfected with a fill and the Strep-SBP heterodimerization system for the removal of axonal ERES components (H). Quantification of primary axon length (I) and total axon arborization (J). Arrowheads point to axons. (K-M) Representative images of DIV4 neurons transfected with a fill and scramble shRNA or shRNAs targeting HDLBP, ZW10, NBAS or SEC22B (K). Quantification of primary axon length (L) and total axon arborization (M). Arrowheads point to axons. Data are presented as mean values ± SEM in (C, E, G, I, J, L, M). Individual data points each represent a neuron, and each color per condition represents an independent experiment. ns = non-significant, **p < 0.01, ***p < 0.001, ****p<0.001 comparing conditions to control using Mann-Whitney test in (C, E (SEC23A), G, Ι) or unpaired t-test in (E(α-SEC31Α), J), or Kruskal-Wallis test followed by Dunn’s multiple comparisons test in (L, M). Scale bars represent 10 μm in (B, D, F), 100 μm in overview images in (H, K), and 20 μm in axon crops in (H).

Article Snippet: The SEC23A fragment was PCR amplified from EGFP-SEC23A (Addgene plasmid #66609) and inserted into either mCh-SBP-C1 or GFP(A206K)-SBP-C1 plasmids between SalI and BamHI restriction sites.

Techniques: Transfection, Control, Staining, Labeling, shRNA, MANN-WHITNEY

Journal: bioRxiv

Article Title: The axonal ER couples translation and secretion machineries for local delivery of axonal transmembrane proteins to promote axonal development

doi: 10.1101/2025.09.09.674816

Figure Lengend Snippet: (A) Volcano plot showing the interactome of SEC13 in neurons. Proteins that are enriched near SEC13 are in yellow and potential key candidates are highlighted in magenta. (B) Representative images of SYT1 translation sites with Puro-PLA assay in close proximity to SEC23A in the axon. (C-D) Distribution of endogenous HDLBP (C), and endogenous HDLBP, NBAS and ZW10 and low expression of SEC22B in axons from neurons treated or not with BFA (D). (E-J) Localization and enrichment of ZW10 (E), NBAS (G) and SEC22B (I) near SEC23A in DIV10 axons and magnifications of merged images. Intensity profile lines from magnified merged images are shown in (F, H and J). (K-L) Localization of SEC22B near Golgi-bypassing RUSH-SYT1 cargos after 4h biotin release in DIV10 axons, treated with BFA and BDNF. Intensity profile line from magnified merged image is shown in (L). (M-O) Time series showing colocalization and co-movements of SEC22B with Golgi-bypassing RUSH-SYT cargos after BFA treatment for 30 minutes (M), ZW10 (N) or NBAS (O). Images were acquired at 1-second intervals for 3 minutes. Arrowheads point to the colocalized regions. See also related Figure S6 and Video S5. Scale bars represent 5 μm in (B, E, G, I, K, M, N, O), 1 μm in magnified images in (E, G, I, K), and 10 μm in (C, D).

Article Snippet: The SEC23A fragment was PCR amplified from EGFP-SEC23A (Addgene plasmid #66609) and inserted into either mCh-SBP-C1 or GFP(A206K)-SBP-C1 plasmids between SalI and BamHI restriction sites.

Techniques: Expressing

Journal: bioRxiv

Article Title: The axonal ER couples translation and secretion machineries for local delivery of axonal transmembrane proteins to promote axonal development

doi: 10.1101/2025.09.09.674816

Figure Lengend Snippet: (A-B) Representative images of DIV17 neurons transfected with a fill and SBP-SEC23A (control) or with Strep-KIFC1 (SEC23A pulled) as described in . Staining for endogenous Synapsin-I was performed to label mature pre-synaptic boutons. Arrowheads point to boutons positive for Synapsin-I (A). Quantification of mature bouton number in 50 μm axon length (B). (C-D) Representative images of DIV17 neurons transfected with a fill and scramble shRNA or shRNAs targeting HDLBP, ZW10, NBAS, or SEC22B (C). Quantification of mature bouton number in 50 μm axon length (D). (E) Coupling of local translation and secretion in the axon. Locally translated TMPs exit the ER via axonal ERES, followed by their delivery to the PM. This process is dependent on the translation regulator HDLBP and NRZ-SEC22B tethering complex and is enhanced upon cue stimulation. Removal of axonal ERES components or KD of proteins involved in unconventional secretion results in reduced axon growth and impaired pre-synaptic bouton assembly. Data are presented as mean values ± SEM in (B, D). Individual data points each represent an axon segment, and each color per condition represents an independent experiment. ****p<0.001 comparing conditions to control using unpaired t-test in (B) or Kruskal-Wallis test followed by Dunn’s multiple comparison test in (D). Scale bars represent 10 μm in (A, C).

Article Snippet: The SEC23A fragment was PCR amplified from EGFP-SEC23A (Addgene plasmid #66609) and inserted into either mCh-SBP-C1 or GFP(A206K)-SBP-C1 plasmids between SalI and BamHI restriction sites.

Techniques: Transfection, Control, Staining, shRNA, Comparison

Journal: bioRxiv

Article Title: The axonal ER couples translation and secretion machineries for local delivery of axonal transmembrane proteins to promote axonal development

doi: 10.1101/2025.09.09.674816

Figure Lengend Snippet: (A-B) Representative images of DIV9-10 axons expressing SEC23A together with SEC24D, SEC31A or SEC16B (A). Quantification of colocalization between SEC23A and SEC24D, SEC31A or SEC16B (B). (C) Representative still and time-lapse from zoomed regions showing the tight association between SEC23A and the axonal ER labelled with SEC61β. Images were acquired at 1-second intervals for 80 seconds. See Video S4. (D-F) Schematic showing the Strep-SBP heterodimerization system using Strep-KIFC1 and SBP-RTN4 to relocate axonal ER to the soma (D). Representative images of SEC23A and RTN4 in DIV10 neurons in the absence (control) or presence of KIFC1 motor (pulled) (E). Quantification of SEC23A number from conditions in (E) in 100 μm axons (F). (G-J) Schematic showing the FKBP-FRB heterodimerization system using KIFC1-FRB and FKBP-SEC23A to relocate axonal ERES components to the soma (G). Representative images of SEC23A treated with ethanol (vehicle, control) or Rapalog for 16h (H). Representative images of RUSH-SYT1 cargos in neurons treated as in (H) for 16h, prior biotin addition for 4h in the presence of BFA and BDNF (I). Quantification of RUSH-SYT1 cargo number from conditions in (I) in 100 μm axons (J). (K-L) Distribution of SEC23A in the axon in control BSA and after 30 min BDNF stimulation (K). Quantification of SEC23A puncta number per 100 μm axon (L). (M-O) Schematic showing the timeline of different treatments before fixation (M). Representative images of DIV10-11 neurons expressing RUSH-SYT1 after 4h biotin release, 4h biotin release and pre-treated with BFA alone, or 4h biotin release together with BFA and BDNF. Live cell surface labeling for HA-tag inserted in the luminal/extracellular domain of RUSH-SYT1, allows for the visualization of SYT1 fusion with the PM (N). Quantification of the percentage of released cargos fusing with the PM (O). See also related Figure S5. Data are presented as box-and-whisker plots in (B, F, J, L, O). Individual data points each represent a neuron, and each color per bar represents an independent experiment. *p < 0.05, **p < 0.01, *** p < 0.001, ****p<0.001 comparing conditions using unpaired t-test in (F, J, L) or ordinary one-way ANOVA test followed by Tukey’s multiple comparisons test in (O). Scale bars represent 10 μm in (A, E, H, I, K, N), 5 μm in the overview image, and 1 μm in cropped images in (C).

Article Snippet: These primers were used to generate this construct: KIFC1 Fw: 5’ – tacaaagacgatgacgacaagaccggtatcctctggcatgagatgtggcatgaag – 3’ KIFC1 Rv: 5’ – cgctagcttcgaagaattcttacttcctgttggcctgagcagt – 3’ FRB Fw: 5’ – tacaaagacgatgacgacaagaccggtatcctctggcatgagatgtggcatgaag – 3’ FRB Rv: 5’ – gcagcggagccagcggatccctttgagattcgtcggaacacatgataatagagg – 3’ 20aa linker: 5’ – gaattcgccagaaccagcagcagatccagcgccagaacctgcagcggagccagcggatcc – 3’ FLAG tag: 5’ – gctgcaggtcgactctagagccaccatggactacaaagacgatgacgacaagaccggt – 3’ For mCh-FKBP-SEC23A or GFP-FKBP-SEC23A, SEC23A was PCR amplified from EGFP-SEC23A (Addgene plasmid #66609) and 2x FKBP was amplified from mCh-FKBP2x-RTN4.

Techniques: Expressing, Control, Labeling, Whisker Assay

Journal: bioRxiv

Article Title: The axonal ER couples translation and secretion machineries for local delivery of axonal transmembrane proteins to promote axonal development

doi: 10.1101/2025.09.09.674816

Figure Lengend Snippet: (A-C) Schematic showing the Strep-SBP heterodimerization system using Strep-KIFC1 and SBP-SEC23A to relocate axonal ERES components to the soma (A). Representative images of neurons DIV9 co-transfected with SBP-SEC23A and V5-SEC13 in the absence (control) or presence of Strep-KIFC1 (pulled) (B). Quantification of SEC23A and SEC13 puncta in axon (C). (D-E) Representative images of neurons transfected with SBP-SEC23A alone or with Strep-KIFC1 and stained for endogenous SEC31A (D). Quantification of SEC23A and endogenous SEC31A puncta in the axon (E). (F-G) Representative images of neurons transfected with SBP-SEC23A alone or with Strep-KIFC1 and stained for endogenous RTN4 for axonal ER labeling (F). Quantification of average ER intensity in the axon (G). (H-J) Representative images of DIV4 neurons transfected with a fill and the Strep-SBP heterodimerization system for the removal of axonal ERES components (H). Quantification of primary axon length (I) and total axon arborization (J). Arrowheads point to axons. (K-M) Representative images of DIV4 neurons transfected with a fill and scramble shRNA or shRNAs targeting HDLBP, ZW10, NBAS or SEC22B (K). Quantification of primary axon length (L) and total axon arborization (M). Arrowheads point to axons. Data are presented as mean values ± SEM in (C, E, G, I, J, L, M). Individual data points each represent a neuron, and each color per condition represents an independent experiment. ns = non-significant, **p < 0.01, ***p < 0.001, ****p<0.001 comparing conditions to control using Mann-Whitney test in (C, E (SEC23A), G, Ι) or unpaired t-test in (E(α-SEC31Α), J), or Kruskal-Wallis test followed by Dunn’s multiple comparisons test in (L, M). Scale bars represent 10 μm in (B, D, F), 100 μm in overview images in (H, K), and 20 μm in axon crops in (H).

Article Snippet: These primers were used to generate this construct: KIFC1 Fw: 5’ – tacaaagacgatgacgacaagaccggtatcctctggcatgagatgtggcatgaag – 3’ KIFC1 Rv: 5’ – cgctagcttcgaagaattcttacttcctgttggcctgagcagt – 3’ FRB Fw: 5’ – tacaaagacgatgacgacaagaccggtatcctctggcatgagatgtggcatgaag – 3’ FRB Rv: 5’ – gcagcggagccagcggatccctttgagattcgtcggaacacatgataatagagg – 3’ 20aa linker: 5’ – gaattcgccagaaccagcagcagatccagcgccagaacctgcagcggagccagcggatcc – 3’ FLAG tag: 5’ – gctgcaggtcgactctagagccaccatggactacaaagacgatgacgacaagaccggt – 3’ For mCh-FKBP-SEC23A or GFP-FKBP-SEC23A, SEC23A was PCR amplified from EGFP-SEC23A (Addgene plasmid #66609) and 2x FKBP was amplified from mCh-FKBP2x-RTN4.

Techniques: Transfection, Control, Staining, Labeling, shRNA, MANN-WHITNEY

Journal: bioRxiv

Article Title: The axonal ER couples translation and secretion machineries for local delivery of axonal transmembrane proteins to promote axonal development

doi: 10.1101/2025.09.09.674816

Figure Lengend Snippet: (A) Volcano plot showing the interactome of SEC13 in neurons. Proteins that are enriched near SEC13 are in yellow and potential key candidates are highlighted in magenta. (B) Representative images of SYT1 translation sites with Puro-PLA assay in close proximity to SEC23A in the axon. (C-D) Distribution of endogenous HDLBP (C), and endogenous HDLBP, NBAS and ZW10 and low expression of SEC22B in axons from neurons treated or not with BFA (D). (E-J) Localization and enrichment of ZW10 (E), NBAS (G) and SEC22B (I) near SEC23A in DIV10 axons and magnifications of merged images. Intensity profile lines from magnified merged images are shown in (F, H and J). (K-L) Localization of SEC22B near Golgi-bypassing RUSH-SYT1 cargos after 4h biotin release in DIV10 axons, treated with BFA and BDNF. Intensity profile line from magnified merged image is shown in (L). (M-O) Time series showing colocalization and co-movements of SEC22B with Golgi-bypassing RUSH-SYT cargos after BFA treatment for 30 minutes (M), ZW10 (N) or NBAS (O). Images were acquired at 1-second intervals for 3 minutes. Arrowheads point to the colocalized regions. See also related Figure S6 and Video S5. Scale bars represent 5 μm in (B, E, G, I, K, M, N, O), 1 μm in magnified images in (E, G, I, K), and 10 μm in (C, D).

Article Snippet: These primers were used to generate this construct: KIFC1 Fw: 5’ – tacaaagacgatgacgacaagaccggtatcctctggcatgagatgtggcatgaag – 3’ KIFC1 Rv: 5’ – cgctagcttcgaagaattcttacttcctgttggcctgagcagt – 3’ FRB Fw: 5’ – tacaaagacgatgacgacaagaccggtatcctctggcatgagatgtggcatgaag – 3’ FRB Rv: 5’ – gcagcggagccagcggatccctttgagattcgtcggaacacatgataatagagg – 3’ 20aa linker: 5’ – gaattcgccagaaccagcagcagatccagcgccagaacctgcagcggagccagcggatcc – 3’ FLAG tag: 5’ – gctgcaggtcgactctagagccaccatggactacaaagacgatgacgacaagaccggt – 3’ For mCh-FKBP-SEC23A or GFP-FKBP-SEC23A, SEC23A was PCR amplified from EGFP-SEC23A (Addgene plasmid #66609) and 2x FKBP was amplified from mCh-FKBP2x-RTN4.

Techniques: Expressing

Journal: bioRxiv

Article Title: The axonal ER couples translation and secretion machineries for local delivery of axonal transmembrane proteins to promote axonal development

doi: 10.1101/2025.09.09.674816

Figure Lengend Snippet: (A-B) Representative images of DIV17 neurons transfected with a fill and SBP-SEC23A (control) or with Strep-KIFC1 (SEC23A pulled) as described in . Staining for endogenous Synapsin-I was performed to label mature pre-synaptic boutons. Arrowheads point to boutons positive for Synapsin-I (A). Quantification of mature bouton number in 50 μm axon length (B). (C-D) Representative images of DIV17 neurons transfected with a fill and scramble shRNA or shRNAs targeting HDLBP, ZW10, NBAS, or SEC22B (C). Quantification of mature bouton number in 50 μm axon length (D). (E) Coupling of local translation and secretion in the axon. Locally translated TMPs exit the ER via axonal ERES, followed by their delivery to the PM. This process is dependent on the translation regulator HDLBP and NRZ-SEC22B tethering complex and is enhanced upon cue stimulation. Removal of axonal ERES components or KD of proteins involved in unconventional secretion results in reduced axon growth and impaired pre-synaptic bouton assembly. Data are presented as mean values ± SEM in (B, D). Individual data points each represent an axon segment, and each color per condition represents an independent experiment. ****p<0.001 comparing conditions to control using unpaired t-test in (B) or Kruskal-Wallis test followed by Dunn’s multiple comparison test in (D). Scale bars represent 10 μm in (A, C).

Article Snippet: These primers were used to generate this construct: KIFC1 Fw: 5’ – tacaaagacgatgacgacaagaccggtatcctctggcatgagatgtggcatgaag – 3’ KIFC1 Rv: 5’ – cgctagcttcgaagaattcttacttcctgttggcctgagcagt – 3’ FRB Fw: 5’ – tacaaagacgatgacgacaagaccggtatcctctggcatgagatgtggcatgaag – 3’ FRB Rv: 5’ – gcagcggagccagcggatccctttgagattcgtcggaacacatgataatagagg – 3’ 20aa linker: 5’ – gaattcgccagaaccagcagcagatccagcgccagaacctgcagcggagccagcggatcc – 3’ FLAG tag: 5’ – gctgcaggtcgactctagagccaccatggactacaaagacgatgacgacaagaccggt – 3’ For mCh-FKBP-SEC23A or GFP-FKBP-SEC23A, SEC23A was PCR amplified from EGFP-SEC23A (Addgene plasmid #66609) and 2x FKBP was amplified from mCh-FKBP2x-RTN4.

Techniques: Transfection, Control, Staining, shRNA, Comparison